Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: BE405552

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	BE405552  [ Marker Report ]
Locus	HD012A21 HD020H15 D1.1_ctg4219 Sr35 XBE405552
Reference	Zhang W et al. (2010) Genetic Maps of Stem Rust Resistance Gene Sr35 in Diploid and Hexaploid Wheat Crop Science 50:2464-2474. Zhang W et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr35 MAS Wheat. Marker Assisted Selection in Wheat.
Type	Indel PCR
PCR primers	BE405552-F CACCATCTTCGTCACCATCA BE405552-R CACAGTGCAGCGAACAGAT
Amplification Conditions	Touch down from 63°C to 59°C (9 cycles of 20 sec, -0.5°C each) Amplification at 58°C (34 cycles of 20 sec each)
Source Species	Triticum aestivum