Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: KASP_58449

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	KASP_58449
Locus	KASP_58449
Reference	Nsabiyera V et al. (2018) Characterisation and mapping of adult plant stripe rust resistance in wheat accession Aus27284 Theoretical and Applied Genetics 131:1459-1467.
General Remarks	Capitalized nucleotides in the FAM and HEX primer sequences are common among KASP probes. Lower case nucleotides are specific to this probe.
Type	KASP
PCR primers	Allele 1 primer FAM: GAAGGTGACCAAGTTCATGCTaaccctcgccaagctcat Allele 2 primer HEX: GAAGGTCGGAGTCAACGGATTaaccctcgccaagctcac Common/Reverse primer agtatccaatcacgacgacg
Source Species	Triticum aestivum