Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG497

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG497  [ Marker Report ]
Locus	ABG497 [ Show all 6 ]
Synonym	Synonym HAR35_11854
Type	Genomic STS
STS primers	5' GGATGAGGAGATACATGGAGC 5' CATTTGGTGGTCAACAAGGC
STS size	ca. 500
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	BH854365 BH854364 ABG497-5 ABG497-3
Source Species	Hordeum vulgare