Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG398

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG398  [ Marker Report ]
Locus	Xabg398-3 ABG398
Synonym	Synonym HAR35_16766
External Databases	DDBJ EMBL GenBank
Reference	Kleinhofs A et al. (1993) A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome Theoretical and Applied Genetics 86:705-712.
Type	Genomic STS
PCR primers	AAGTGATGGAATTCAGAAAG AAGCGGTTCCTTTTGTTACT
Sequence	L43992 ABG398
Linkage Group	3
Source Species	Hordeum vulgare
Source Germplasm	Shin Ebisu 16
Insert Size	0.4