Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG358

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG358  [ Marker Report ]
Locus	ABG358 ABG358-2H
Synonym	Synonym HAR35_4004
Reference	Kleinhofs A et al. (1993) A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome Theoretical and Applied Genetics 86:705-712.
General Remarks	Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' ATTCCAGAACCTCCTCGAC 5' AAGCCACATCAACATAATGC
STS size	150
Amplification Conditions	STS annealing temperature 50-52 oC
Sequence	L43981 ABG358 ABG358-5
Linkage Group	2S 2
Source Species	Hordeum vulgare
Source Germplasm	Shin Ebisu 16
Insert Size	0.4