Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG317

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG317  [ Marker Report ]
Locus	ABG317 ABG317A ABG317B
Synonym	Please see p3V
External Databases	DDBJ EMBL GenBank
General Remarks	Verify plasmid by cutting w/HEB: this chops up the insert and leaves the vector intact. The pieces add up to 2.7kb.
Type	STS
PCR primers	CATGATGGGTCAAGCTCTGT AACTCTGGGTGGTTTGTGAA
Sequence	L43976 ABG317
Linkage Group	2
Source Species	Hordeum vulgare
Insert Size	2.7