Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG316

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG316  [ Marker Report ]
Locus	ABG316f [ Show all 8 ]
Synonym	Please see p13XB(1.1) Synonym HAR35_31000
External Databases	DDBJ EMBL GenBank
General Remarks	The 2.4 kb fragment from this clone is ABG319.
Type	Genomic STS
PCR primers	CCAATTGTGTGAATGGATGT CGTAAGAAGGAGAAGATGAC
Sequence	L43975 ABG316
Linkage Group	3 Barley 7 (5H) 2
Source Species	Hordeum vulgare
Insert Size	1.1 1