Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG315

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG315  [ Marker Report ]
Locus	Xabg315-3 ABG315
Synonym	Please see p6V Synonym HAR35_43645
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TTTTAATCCACCCCCTCACC GACTTGCCATGTTTTAATCG
Sequence	L43974 ABG315
Linkage Group	3
Source Species	Hordeum vulgare
Source Germplasm	Bomi (barley)
Insert Size	3.7