Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG55

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG55  [ Marker Report ]
Locus	ABG055 [ Show all 18 ]
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	ATCCGCAGCAGATCGAGGAC CAGGCAAGATTGACGCAGTA
Sequence	L44040 ABG55
Source Species	Hordeum vulgare