Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG20

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG20  [ Marker Report ]
Locus	ABG20 [ Show all 13 ]
General Remarks	Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' GGCAACCGCAAGAAAGAAAG 5' CCTCTCATGTCAGAGCATTT
STS size	254
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	L43971 ABG20 ABG20-5 ABG20-3
Linkage Group	Group 6
Source Species	Hordeum vulgare
Insert Size	1.3