Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG8

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG8  [ Marker Report ]
Locus	Xabg8-2 ABG8 ABG008 ABG008-2H
Type	Genomic STS
PCR primers	GTTTATGTTTTCCAATTCAT TTAACAACTGATGTGTGAGT
Sequence	BH854349 BH854350 ABG8-5 ABG8-3
Linkage Group	2
Source Species	Hordeum vulgare
Source Germplasm	Shin Ebisu 16
Insert Size	1.5