Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: BCD327

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	BCD327  [ Marker Report ]
Locus	Xbcd327-4D [ Show all 8 ]
Synonym	Synonym HAR35_28662 HAR35_35040 HAR35_4710
Reference	Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks	Lambda ZAP II library Bar.LambZAPII [c] Bar.LambZAPII
Type	cDNA STS
PCR primers	R:ACGAGCAGAAGCCAAGCCAA L:GGCACGAGGCACAAACTTGA
Amplification Conditions	Anneal at 45oC
Sequence	BE438638 BE438695 BE438787 BCD327_WHE1A0121 BCD327_WHE1A0122
Polymorphism	BCD327 EcoRI
Linkage Group	4S
Insert Enzyme	EcoRI
Source Species	Hordeum vulgare
Source Germplasm	Willis
Source Tissue	etiolated leaf leaf
Insert Size	1.6
PCR size	1.6