Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: BCD129

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	BCD129  [ Marker Report ]
Locus	BCD129 [ Show all 7 ]
Reference	Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks	Lambda ZAP II library Bar.LambZAPII [c] Bar.LambZAPII
Type	cDNA STS
PCR primers	CAACAATATGGGCATTACAT CGAGGAGTTCTACAAATCAT
Sequence	L44096 BCD129
Polymorphism	BCD129 EcoRI
Linkage Group	[b 1S]
Insert Enzyme	EcoRI
Source Species	Hordeum vulgare
Source Germplasm	Willis
Source Tissue	etiolated leaf
Insert Size	2
PCR size	2