Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: BARC173

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	BARC173  [ Marker Report ]
Locus	Xbarc173-6D [ Show all 7 ]
Reference	Olson EL et al. (2013) Introgression of stem rust resistance gene SrTA10187 and SrTA10171 from Aegilops tauschii to wheat Theoretical and Applied Genetics 126:2477-2484. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. SrTA10187 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks	Contains motif : (ATT)29(TAG)8(CAA)4 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GGGGATCCTTCAACAATAACA 3' 5' GCGAGATGGCATTTTTAAATAAAGAGAC 3'
Amplification Conditions	Annealing temperature = 50
Sequence	BV211532
Source Gene	SrTA10187
Source Species	Triticum aestivum