Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MAMA_8

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MAMA_8
Locus	MAMA_8
Reference	Wight CP et al. (2010) A set of new simple sequence repeat and avenin DNA markers suitable for mapping and fingerprinting studies in oat (Avena spp.) Crop Science 50:1207-1218.
Type	SSR
PCR primers	Forward (5'-3') AGTTGGTGGGTTGTTTTGATG Reverse (5'-3') CTCGCAAAAGAGAGCCCTTC
Source Species	Avena sativa