Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: WMC401

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	WMC401  [ Marker Report ]
Locus	Xwmc401-2A Xwmc401 wmc401-2A
Reference	Somers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks	Wheat Microsatellite Consortium Project 1, Plate reference 22d9 Donor: Romestant, RAGT Trimmed to Ssp1 at 5' end and to insert at 3' end. Bases 10 to 52 show homology to 19c3 bases 7 to 49 (43 in longest run, maxScore = 54). (GT)10 119 to 138. Bases 22 to 52 show homology to 26g7 bases 172 to 202 (complement) (31 in longest run, maxScore = 58).
Type	PCR SSR
PCR primers	Forward tcgtcacctcttctcttcttgt at 6 length 22 bases, Tm 60 Reverse CCTCTAGGGCATATTTCCTTCA at 154 length 22 bases, Tm
SSR size	170 bases expected, Chinese Spring
Amplification Conditions	61C anneal, polymorphic on acrylamide.
Sequence	WMC401
Source Species	Triticum aestivum