Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: WMC190

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	WMC190  [ Marker Report ]
Locus	Xwmc190
Reference	Somers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks	Wheat Microsatellite Consortium Project 1, Plate reference 4e8 Donor: Morell, Canberra Trimmed to insert at 5' end. Multiple inserts in this clone joined at 499-516 by linkers. (GT)31 64 to 125, The wmpE08 primers give better results. Raeleen Jennings, personal communication
Type	PCR SSR
PCR primers	Forward gccTccggcAcgTggAcTAAcA at 18 length 22 bases, Tm 72 Reverse cgTgcTTgAggTcTccgAcATc at 290 length 22 bases, Tm 68 wmpE08F CGGGTCGCCTCAACGGTGTGT wmpE08R GCGCTTGGCTTGTGGACAGTT
SSR size	294 bases expected, Chinese Spring
Amplification Conditions	61C anneal, product; 51C anneal, product; 51C anneal, polymorphic on acrylamide.;
Sequence	WMC190
Source Species	Triticum aestivum