GrainGenes Probe Report: WBE103
[Submit comment/correction][What is a probe?]
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
Probe
WBE103 [ Marker Report ]
Locus
WBE103
Reference
General Remarks
Restriction Enzyme for CAPS marker is Taq I
PCR primers
5' ggtggccctggtgaactacg 3'
5' ctggctttaagaacactggaacat 3'
Amplification Conditions
5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 62 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Source Species
Hordeum vulgare
GrainGenes Probe Report: WBE103
[Submit comment/correction][What is a probe?]
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
|
| ||
|
| ||
| |||
|
| ||
|
| ||
|
| ||
|
|