Query (optional)   in Class  

GrainGenes Probe Report: WBE103

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
WBE103  [ Marker Report ]
Locus
WBE103
Reference
ReferenceMarcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
General Remarks
Restriction Enzyme for CAPS marker is Taq I
PCR primers
5' ggtggccctggtgaactacg 3'
5' ctggctttaagaacactggaacat 3'
Amplification Conditions
5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 62 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Source Species
Hordeum vulgare