Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: STSJ15

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	STSJ15  [ Marker Report ]
Locus	STSJ15 STSJ15-4D
General Remarks	Primer set was designed from a RAPD fragment which marks the 4Ai (Agropyron intermedian) translocation containing Wsm1 from KS93WGRC27.
Type	PCR STS
PCR primers	R:CCGAGCTCACACGCTAATTT L:GTAGCAGGGGAAGCTGAAGA
Amplification Conditions	Anneal at 45oC
Linkage Group	Linked to Wsm1 on 4Ai translocation
Source Species	Triticum aestivum
Source Germplasm	KS93WGRC27
Source Tissue	leaf
Insert Size	0.4