Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABC05599_L01R01

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABC05599_L01R01  [ Marker Report ]
Locus	scssr05599
Data at Germinate	ABC05599
Data at PLEXdb	Barley1_05599
General Remarks	Estimated product size = 186 BarleySNP type = Contig Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc05599
PCR primers	5' TTCCATCATAACAGCAATGG 5' TTCGTCGAAGGCTATGTAGG
Sequence	Barley1_05599
Source Species	Hordeum vulgare