Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: pTtksuG9

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	pTtksuG9  [ Marker Report ]
Locus	KSUG9 [ Show all 17 ]
Type	Genomic STS
PCR primers	R:GAGCCTGATGAAGACATTAC L:CGAGTTAAGTCCTTGTATCG
Polymorphism	KSUG9 EcoRI
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.4