Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: pTtksuG5

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	pTtksuG5  [ Marker Report ]
Locus	XksuG5-2 [ Show all 16 ]
Type	Genomic STS
PCR primers	R:AACAGAGCTTGATGTCTCAC L:CAATACAACAGTTCAGGTGGC
Polymorphism	KSUG5 XbaI
Linkage Group	2D / 2D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.5