Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: pTtksuE6

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	pTtksuE6  [ Marker Report ]
Locus	DGE6 E006 XksuE6
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
General Remarks	Previous PCR_primers R:AATCAAGAAGGACAATGCC, L:TGCAGCATTCTGGAACATGC don't work as well.
Type	Genomic STS
PCR primers	R:CCAACGAGTACTCCCTCGGC L:GTATCTCTTCATGCACGTTC
Amplification Conditions	Anneal at 50oC
Linkage Group	4D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Source Tissue	leaf
Insert Size	1.9