Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: pTtksuD8

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	pTtksuD8  [ Marker Report ]
Locus	XksuD8 [ Show all 8 ]
Type	Genomic STS
PCR primers	R:GGATGTCTCATATGCATGCAC L:ACTGTCTGTGCCTTGTGATC
Specificity	Primer specificity verified, maps on chromosome 2BS.
Linkage Group	2D / 2D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.5