Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: PSP3200

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	PSP3200  [ Marker Report ]
Locus	Xpsp3200-6D Xpsp3200 SrTA10187 psp3200
Reference	Olson EL et al. (2013) Introgression of stem rust resistance gene SrTA10187 and SrTA10171 from Aegilops tauschii to wheat Theoretical and Applied Genetics 126:2477-2484. Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949. Bryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. SrTA10187 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks	Insert contains repeat (AAG)16
Type	PCR SSR
PCR primers	Forward GTTCTGAAGACATTACGGATG Reverse GAGAATAGCTGGTTTTGTGG
SSR size	170, 6D locus
Amplification Conditions	61C anneal
Source Gene	SrTA10187
Source Species	Triticum aestivum