Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: PGK

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	PGK
Locus	Xpgk
Synonym	Other name X73528
Reference	Jones PG et al. (1995) Nucleotide sequence of a wheat chloroplastic phosphoglycerate kinase gene Plant Physiology 107:1483-1484.
General Remarks	Primers designed from wheat phosphoglycerate kinase gene.
Type	PCR STS
PCR primers	R:CCATTTGCCAGGTCAGCCAC L:TACCTCCTCAGCAACGGCGC
Amplification Conditions	Anneal at 50oC.
Sequence	X73528
Linkage Group	Fragment amplified by primers mapped to 2D.
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring
PCR size	0.859