Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: PETF

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	PETF
Synonym	Other name X75089
Reference	Bringloe DH et al. (1995) Developmental, circadian and light regulation of wheat ferredoxin gene expression. Plant Molecular Biology 27:293-306.
General Remarks	Primers designed from wheat ferredoxin gene.
Type	PCR STS
PCR primers	R:GGTGTATCTGGCAATGTCCG L:CACCTCCTCAGCCACACCTA
Amplification Conditions	Anneal at 50oC.
Sequence	X75089
Linkage Group	Fragments amplified by primers mapped to 3B, 4D.
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring
PCR size	0.586