Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABC04260_L01R01

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABC04260_L01R01  [ Marker Report ]
Locus	scsnp04260
Data at Germinate	ABC04260
Data at PLEXdb	Barley1_04260
General Remarks	Estimated product size = 194 BarleySNP type = SNP From EST Technology platform used = PyrosequencingTM Technology Affymetrix contig name = abc04260
Type	STS
PCR primers	5' CACCGACCCATGGAAATAAC 5' CGAGGTCGTCAAGATGGACT
Sequence	Barley1_04260
Source Species	Hordeum vulgare