Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG977

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG977  [ Marker Report ]
Locus	MWG977
Synonym	Synonym HAR35_49989
Type	Genomic STS
STS primers	5' AACCTGAATAACTGCTACGGC 5' TGCTGAATTTACTTGCTGCC
STS size	195
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234694 AJ234693 MWG977-5 MWG977-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare