Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG975

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG975  [ Marker Report ]
Locus	MWG975 [ Show all 6 ]
Synonym	Synonym HAR35_19914 HAR35_8093 HAR35_8094
Type	Genomic STS
STS primers	5' GATTGCCACATCGCGAACAGGCCTGC 5' GTACTGCGTGGTTGTGGACGTGGCTT
STS size	178
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234692 AJ234691 MWG975 MWG975-5 MWG975-3
Polymorphism	MWG975 DraI
Insert Enzyme	PstI
Source Species	Hordeum vulgare