Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG916

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG916  [ Marker Report ]
Locus	MWG916 [ Show all 7 ]
Synonym	Synonym HAR35_35585
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
General Remarks	Restriction enzyme informative in CAP analysis is HaeIII
Type	Genomic STS
STS primers	5' GCGGACCAGATCAATATCGA 5' CGACGTAGGGAAACACGCAT
STS size	196
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234646 AJ234645 MWG916-5 MWG916-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare