Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG844

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG844  [ Marker Report ]
Locus	MWG844a [ Show all 8 ]
Synonym	Synonym HAR35_26589 HAR35_42594 HAR35_9645
Type	Genomic STS
STS primers	5' TCAGGAACCTGGCACCAACG 5' CATCAGCCCGCGATACATCC
STS size	374
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234585 MWG844-5
Polymorphism	MWG844 EcoRI
Insert Enzyme	PstI
Source Species	Hordeum vulgare