Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG835

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG835  [ Marker Report ]
Locus	MWG835 [ Show all 7 ]
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Type	Genomic STS
STS primers	5' TTCCCTATTCAAGCCATCAGCAAA 5' GTAACCCATAGATAGCATCTTGTG
STS size	565
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 65 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234580 MWG835-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare