Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG798

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG798  [ Marker Report ]
Locus	MWG798A [ Show all 8 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GGCTGTCTACATCTTCTGCA 5' CAAGTGTTGAGAAGGAGAGT
STS size	365
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234554 AJ234553 MWG798-5 MWG798-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare