Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG773

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG773
Synonym	Please see cMWG773
Reference	Kunzel G et al. (2000) Integration of deletion breakpoints of chromosome 7H (1) into the Igri/Franka-derived RFLP Barley Genetics Newsletter 30:24-27.
General Remarks	cMWG773 is the correct designation. MWG773 does not exist. (Personal communication from Andreas Graner, September 2005.)
STS primers	5' TGCCCAATTAACCATGAACC 5' TCAGGCTCTGAATGAATCTCG
STS size	228
Amplification Conditions	STS annealing temperature 52 - 55 oC