Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG502

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG502  [ Marker Report ]
Locus	MWG502 Xmwg502 Xmwg502-5R
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500. Sayed-Tabatabaei BE et al. (1998) DNA sequencing and primer designing for RFLP clones evenly distributed in the barley genome. Barley Genetics Newsletter 28:15-18. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks	Restriction Enzyme for CAPS marker is Msp I; Hpa II
Type	Genomic STS
PCR primers	5' tgtttagctaagctgttgctgagg 3' 5' ctctgaagcatggaaccagatttg 3'
STS primers	T7 side (5' to 3') ATCAAGATGAGGAAGCTGATGCAGT T3 side (5' to 3') TCTTGTCTGAAGCATGGAACCAGAT
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 55 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234471 AJ234470 MWG502 MWG502-5 MWG502-3
Linkage Group	5H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.9