Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG60

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG60  [ Marker Report ]
Locus	Xmwg060 [ Show all 11 ]
General Remarks	single - low copy probe
Type	Genomic PCR STS
PCR primers	R:CTGGATAGAGAAGCCATGGA L:CAACGATACAACAGGCTCAA
Amplification Conditions	Anneal at 45oC.
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.3