Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MAG3798

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MAG3798  [ Marker Report ]
Locus	Xmag3798
Reference	Xue S et al. (2008) A high-density intervarietal map of the wheat genome enriched with markers derived from expressed sequence tags. Theoretical and Applied Genetics 117:181-189.
Type	STS
PCR primers	Forward ATTGCGAGACGGATAACGAA Reverse GCTTACGAGCGAACATCAGG
Amplification Conditions	Anneal 52
Sequence	BQ905106
Source Species	Triticum aestivum