Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: avgbs_cluster_10762.1_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	avgbs_cluster_10762.1_KASP
Locus	avgbs_cluster_10762.1
Reference	Kebede AZ et al. (2019) Mapping Oat Crown Rust Resistance Gene Pc45 Confirms Association with PcKM G3: Genes, Genomes, Genetics 9:505-511. Bekele WA et al. (2018) Haplotype based genotyping-by-sequencing in oat genome research Plant Biotechnology Journal.
General Remarks	Curator note on the avgbs SNPs: Legacy GBS loci have the 'avgbs' prefix followed by a number with no decimals. Haplotag loci have either a single decimal (for TL-haplotype loci) or two decimals (for SNP loci, where the second decimal identifies the SNP position). All variations of loci will be linked to this Probe record.
Type	KASP
PCR primers	primer avgbs_cluster_10762.1_A1 = TAG1-GCACCTGTTCATACGGGTGATG primer avgbs_cluster_10762.1_A2 = TAG2-GCACCTGTTCATACGGGTGATC primer avgbs_cluster_10762.1_C2 = GCGGCTCAGGCAGCCTCCAA
Source Species	Avena sativa