Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: avgbs_99510.1_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	avgbs_99510.1_KASP
Locus	avgbs_99510.1
Reference	Kebede AZ et al. (2019) Mapping Oat Crown Rust Resistance Gene Pc45 Confirms Association with PcKM G3: Genes, Genomes, Genetics 9:505-511.
Type	KASP
PCR primers	primer avgbs_99510.1_A1 = TAG1-ATCTCGACCAACTTACTTACAGGAC primer avgbs_99510.1_A2 = TAG2-ATATCTCGACCAACTTACTTACAGGAT primer avgbs_99510.1_C2 = GCCTTCCATGTGCTGGATGGAAA
Source Species	Avena sativa