Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GMI_ES14_c1439_83_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GMI_ES14_c1439_83_KASP
Locus	GMI_ES14_c1439_83
Reference	Lin Y et al. (2014) A major quantitative trait locus conferring adult plant partial resistance to crown rust in oat. BMC Plant Biology 14:250.
Type	KASP
PCR primers	Allele-Specific Primer 1 (5'-3') TAG1-CACTGAAACTCAGAAGAGTAGACG Allele-Specific Primer 2 (5'-3') TAG2-GCACTGAAACTCAGAAGAGTAGACA Common Primer 1 (5'-3') GGACAATAACACCACCTTGCGGTTT Common Primer 2 (5'-3') CACCACCTTGCGGTTTACAGCATAA
Source Species	Avena sativa