Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: UBW18

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	UBW18
Locus	ubw18 ubw18a ubw18a-7B ubw18b ubw18b-7B
Reference	Terracciano I et al. (2013) Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.). Theoretical and Applied Genetics 126:1077-1101.
General Remarks	See Table 1 in TAG-126-1077 for allele-specific bases Anneling temperature = 60
Type	COS-SNP
PCR primers	Forward Creso/Colosseo specific F-C: cacgacgttgtaaaacgaCCTCCTCTCTGATGCAATTGTATGTC Forward Lloyd specific F-L: CAATTGTGTCTGCTTCATCGTG R: CCTGGGTTTATTTACTGTCACTAC