Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: CNL127

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	CNL127
Locus	cnl127
Reference	Fu YB and Thompson D (2006) Genetic diversity of bluebunch wheatgrass (Pseudoroegneria spicata) in the Thompson River valley of British Columbia Canadian Journal of Botany 84:1122-1128.
General Remarks	Amplifies repeat (CCT)6
Type	PCR
PCR primers	CACAAGTTCGAGTACTCCATC AAGTGGCGAGCTTTCTGAC