Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: CFB6008

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	CFB6008
Locus	cfb6008 cfb6008-3B
Reference	Graziani, M (2012) Mappaggio fine di un QTL principale per la resa in granella sul cromosoma 3B di frumento duro Dissertation - Universita di Bologna 1-202.
General Remarks	Annealing temp = 60, Allele size = 189
Type	PCR
PCR primers	CTAGCTCCTGCTTCAGGTCG CTGCCAAGCTCAGGACCTAC