Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: HVB23D

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	HVB23D  [ Marker Report ]
Locus	HvB23D
General Remarks	Insert contains repeat (gt)6 SSR size deduced from sequence: 148 bp
Type	PCR
PCR primers	5' GGTAGCAGACCGATGGATGT 3' ACTCTGACACGCACGAACAC
Amplification Conditions	40 cycles touchdown at 94, 64-55, 72 C
Sequence	X76603
Source Gene Class	Oleosin
Source Species	Hordeum vulgare