Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Hv49505

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Hv49505  [ Marker Report ]
Locus	Hv49505
Synonym	Synonym HAR35_46748
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
General Remarks	Insert contains repeat (a)8 Polymorphic Information Content (PIC) = 0.47 in 28 mainly German barley cultivars and two H. spontaneum accessions.
Type	SSR
PCR primers	Left 5' TGTCGGTTGGTGATGTGTCG Right 5' AAAGCAGCAGCAGAACCCAC TGTCGGTTGGTGATGTGTCG AAAGCAGCAGCAGAACCCAC
SSR size	152
Amplification Conditions	Low Stringency: 35 cycles of 1 min at 94 deg C; 1 min at 50 deg C; 2 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	U49505
Source Species	Hordeum vulgare