Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABC00694_L02R02

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABC00694_L02R02  [ Marker Report ]
Locus	scind00694
Data at Germinate	ABC00694
Data at PLEXdb	Barley1_00694
General Remarks	Estimated product size = unknown BarleySNP type = Indel (Domon) Technology platform used = PCR Separation On Agarose Gel (400bp Indel) Affymetrix contig name = abc00694
Type	STS
PCR primers	5' CAAACAGACGACAAGCGGAGAA 5' TAGAAAAAGAAAACATCAAGCA
Sequence	Barley1_00694
Source Species	Hordeum vulgare