Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: AY244515

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	AY244515  [ Marker Report ]
Locus	ADA2
Reference	Yan L et al. (2003) Positional cloning of the wheat vernalization gene VRN1 Proceedings of the National Academy of Sciences, USA 100:6263-6268.
General Remarks	homologous to ADA2 (Transcriptional Adaptor, Zea mays AJ430205)
Type	Genomic STS
PCR primers	ADA2-F GAAGATGCACTTGGAGAAGG ADA2-R GTCTCTTTGCATTGTACCCA
STS size	0.700
Sequence	AY244515
Source Gene Class	Transcriptional adaptor
Source Gene	Ada2-A1 (Triticum)
Source Species	Triticum monococcum
Source Germplasm	T. monococcum L. ssp. aegilopoides G1777