Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: AY244512/3

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	AY244512/3  [ Marker Report ]
Locus	MTK4
Reference	Yan L et al. (2003) Positional cloning of the wheat vernalization gene VRN1 Proceedings of the National Academy of Sciences, USA 100:6263-6268.
General Remarks	Tousled-like kinase MTK4
Type	Genomic STS
PCR primers	MTK4_F GGTAAAAGATGAGCAAGGAG MTK4-R TCTATCTATGGTGAACTCTTACTTC
Sequence	AY244513 AY244512
Source Gene Class	Protein kinase
Source Gene	MTK4-A1 (Triticum)
Source Species	Triticum monococcum