Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: AY244506/7

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	AY244506/7  [ Marker Report ]
Locus	AGLG1
Reference	Yan L et al. (2003) Positional cloning of the wheat vernalization gene VRN1 Proceedings of the National Academy of Sciences, USA 100:6263-6268.
General Remarks	AGLG1 Agamous-like MADS-box transcription factor
Type	Genomic STS
PCR primers	AGLG1-F GACCCTCGAGAGGTACCAG AGLG1-R CATCTACACTACGATCTAGC
Sequence	AY244507 AY244506
Source Gene Class	Transcription factor
Source Gene	Aglg1-A1 (Triticum)
Source Species	Triticum monococcum